CH-Bin

Installation

First clone the CH-Bin repository to a local directory. Note that CH-Bin only supports linux.

git clone https://github.com/kdsuneraavinash/CH-Bin
cd CH-Bin

Dependencies

You will need python and build requirements (and optionally venv). In ubuntu 20.04, you can install them by,

sudo apt-get update
sudo apt-get install cmake
sudo apt-get install build-essential
sudo apt-get install python3 python-is-python3
sudo apt-get install python3-dev
sudo apt-get install python3.8-venv
sudo apt-get install libboost-all-dev

Additionally, FragGeneScan, HMMER and seq2vec tools are required. If you have them already installed, you may provide their paths in the configuration. Otherwise, follow the below steps to install them manually. Following commands will install the required tools in the tools directory.

1. Install FragGeneScan.

   wget -O tools/FragGeneScan1.31.tar.gz https://sourceforge.net/projects/fraggenescan/files/FragGeneScan1.31.tar.gz
   tar -xzf tools/FragGeneScan1.31.tar.gz -C tools
   cd tools/FragGeneScan1.31 && make clean && make fgs && cd ../..
   ./tools/FragGeneScan1.31/run_FragGeneScan.pl

2. Install HMMER.

   wget -O tools/hmmer.tar.gz http://eddylab.org/software/hmmer/hmmer.tar.gz
   tar -xzf tools/hmmer.tar.gz -C tools
   cd tools/hmmer-3.3.2 && ./configure && make && cd ../..
   ./tools/hmmer-3.3.2/src/hmmalign -h

3. Install seq2vec.

   git clone https://github.com/anuradhawick/seq2vec.git tools/seq2vec
   cd tools/seq2vec/ && mkdir -p build && cmake . && make -j8 && cd ../..
   ./tools/seq2vec/seq2vec --help

4. Get marker-gene hmm file.

   wget -O tools/marker.hmm -nc https://raw.github.com/sufforest/SolidBin/4c9b9ea7b8d8a0df1b772669872b69006c490e67/auxiliary/marker.hmm
   head ./tools/marker.hmm

If you installed them in a different directory than tools, you need to update the configuration. Edit config/default.ini as follows, (If you followed the default installation commands provided above, you do not need to change the configuration.)

[COMMANDS]
FragGeneScan = <FragGeneScan Path>
Hmmer = <Hmmer Path>
Seq2Vec = <Seq2Vec Path>

CH-Bin Installation

1. Install using setup.py. (Recommended installing in a virtual environment)

   python -m venv .venv        # Optional: creating venv
   source .venv/bin/activate   # Optional: activating venv
   python setup.py install

2. Then run following command to run the tool.

   ch_bin --contigs [CONTIG_FASTA] --coverages [COVERAGE_TSV] --out [OUT_DIR]

For example, to bin the sample dataset, run the following command.

ch_bin --contigs test_data/five-genomes-contigs.fasta --coverages test_data/five-genomes-abundance.abund --out out

This will create the out directory with the binning assignments. The final binning assignments will be in out/clustering/binning-assignment.csv file. This will be a comma-separated file in the following format. (First column being the contig name and second being the assigned bin index)

CONTIG_NAME,BIN
NODE_100_length_59166_cov_34.037370,2
NODE_101_length_58711_cov_33.859759,2
NODE_102_length_56779_cov_94.096062,1
NODE_103_length_53962_cov_21.469587,3

Furthermore, the FASTA files of the bins will also be dumped into out/clustering/bins directory.

Required File Formats

Contig File

Contig file should be a multi-FASTA file containing the genomes in following format.

>NODE_509_length_56_cov_70.000000
AAGGCTCTTCAGGAATAAGAGTGTAACCACCTGAAACCAACACCCCGATTCCCGGG
>NODE_510_length_56_cov_68.000000
CCAGCAGAACCCCTGGTCCTGCTAACTCGGTGTCCACTACCCGGGGTGAACCTCAC

Coverage File

Coverage file should be a tab-separated file with the following format.

NODE_1_length_1189502_cov_16.379288	16.379288
NODE_2_length_1127036_cov_16.549343	16.549343
NODE_3_length_1009819_cov_16.436396	16.436396
NODE_4_length_861895_cov_21.063754	21.063754
NODE_5_length_737013_cov_20.834031	20.834031
NODE_6_length_659011_cov_21.171279	21.171279

The first column should contain the contig id, as given in the contigs FASTA. Each column after that should refer to the coverages from each sample. (There should be at-least one sample) The example file above shows a coverage file with data taken from one sample.

Coverage File

If you followed the installation document, the requirements should be installed in the tools directory. If so you can skip this section and run the tool directly. If the tools were installed in a different manner, or you want to change some internal configuration, you might want to provide a custom configuration.

Configuration file format

CH-Bin uses a customizable ini file format to store the configuration. The default configuration can be found in config/default.ini.

[COMMANDS]
FragGeneScan = DIR OF run_FragGeneScan.pl
Hmmer = DIR OF Hmmer
Seq2Vec = DIR OF seq2vec

[RESOURCES]
MarkersHmm = PATH OF marker.hmm

[PARAMETERS]
KmerK = INTEGER
ContigLengthFilterBp = INTEGER
ScmCoverageThreshold = FLOAT BETWEEN 0 AND 1
ScmSelectPercentile = FLOAT BETWEEN 0 AND 1
SeedContigSplitLengthBp = INTEGER
AlgoNumNeighbors = INTEGER
AlgoMaxIterations = INTEGER
AlgoDistanceMetric = convex
AlgoQpSolver = EITHER quadprog OR cvxopt
InMemDistMatrix = EITHER yes OR no

If the requirement installations were done differently, you might want to change the COMMANDS section.

Commands/Resource Configuration

For each tool provide the command that can be used to run the specified tool. For example, for FragGeneScan, provide the run_FragGeneScan.pl script location. Note that all the related files should be executable. (In FragGeneScan case, both FragGeneScan and run_FragGeneScan.pl should be executable)

The resource section describes the resource locations. Generally, you do not need to change this section.

Parameters Configuration

In the parameters section, you can adjust the default tool settings. Following table shows available properties.

Parameter	Description
KmerK	K value of the kmers to count.
ContigLengthFilterBp	Threshold to filter the short contigs.
ScmCoverageThreshold	Threshold for a hit to be considered for the seed frequency distribution.
ScmSelectPercentile	Percentile to use for selecting the number of seeds. For example, 0.5 will take the median number of seeds.
SeedContigSplitLengthBp	Length to split the seed contigs.
AlgoNumNeighbors	Number of neighbors to consider for polytope.
AlgoMaxIterations	Number of maximum iterations to perform.
AlgoDistanceMetric	Polytope distance matrix (convex/affine)
AlgoQpSolver	Quadratic programming problem solver. (quadprog/cvxopt)
InMemDistMatrix	Whether to use in-memory or in-disk distance matrix. (yes/no)

Providing Configuration

When running ch_bin you can provide the custom configuration file via, -s or --config parameter.

Development

1. Install the requirements of the project by running

   pip install -r requirements.txt

2. Run the tool via:

   python -m ch_bin.ch_bin

Additionally, linting and type-checking are configured to this project. You may install the git-hooks for the formatters via,

pre-commit install

Type-checking can be done as:

mypy .

Citation

CH-Bin has been accepted at the 20th Asia Pacific Bioinformatics Conference (APBC 2020) and is published in Elsevier Computational Biology and Chemistry; DOI: 10.1016/j.compbiolchem.2022.107734. If you use CH-Bin in your work, please cite CH-Bin as follows.

@article{CHANDRASIRI2022107734,
title = {CH-Bin: A Convex Hull Based Approach for Binning Metagenomic Contigs},
journal = {Computational Biology and Chemistry},
pages = {107734},
year = {2022},
issn = {1476-9271},
doi = {https://doi.org/10.1016/j.compbiolchem.2022.107734},
url = {https://www.sciencedirect.com/science/article/pii/S1476927122001141},
author = {Sunera Chandrasiri and Thumula Perera and Anjala Dilhara and Indika Perera and Vijini Mallawaarachchi},
keywords = {Convex hull, Convex hull distance, Metagenomic binning, Multiple k values, High dimensional data clustering, Clustering algorithm},
abstract = {Metagenomics has enabled culture-independent analysis of micro-organisms present in environmental samples. Metagenomics binning, which involves the grouping of contigs into bins that represent different taxonomic groups, is an important step of a typical metagenomic workflow followed after assembly. The majority of the metagenomic binning tools represent the composition and coverage information of contigs as feature vectors consisting of a large number of dimensions. However, these tools use traditional Euclidean distance or Manhattan distance metrics which become unreliable in the high-dimensional space. We propose CH-Bin, a binning approach that leverages the benefits of using convex hull distance for binning contigs represented by high dimensional feature vectors. We demonstrate using experimental evidence on simulated and real datasets that the use of high dimensional feature vectors to represent contigs can preserve additional information, and result in improved binning results. We further demonstrate that the convex hull distance based binning approach can be effectively utilized in binning such high-dimensional data. To the best of our knowledge, this is the first time that composition information from oligonucleotides of multiple sizes has been used in representing the composition information of contigs and a convex-hull distance based binning algorithm has been used to bin metagenomic contigs. The source code of CH-Bin is available at https://github.com/kdsuneraavinash/CH-Bin.}
}